Cytochrome-C coding comparison in humans and chimps

Here’s a comparison between the cytochrome-C coding in humans and chimps. Differences are marked by gaps in the asterisks.

human_cytc
ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
chimp_cytc
ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCATACC
******************************************************** ***

human_cytc
GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
chimp_cytc
GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTCGGGCGGAAG
************************************************** *********

human_cytc
ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
chimp_cytc
ACAGGTCAGGCCCCTGGATATTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
******************** ***************************************

human_cytc
GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
chimp_cytc
GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
************************************************************

human_cytc
ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
chimp_cytc
ATGATATTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
***** ******************************************************

human_cytc
AAAGCTACTAATGAGTAA
chimp_cytc
AAAGCTACTAATGAGTAA
******************

Reggie McNeal

 mcnealheader.jpg

Rev. Dr. Reggie McNeil is coming to Puget Sound to present:

Spiritual Leadership for the Present Future Church
Saturday, September 22, 2007, 9am – 3pm
North Creek Presbyterian Church
621 164th Street SE
Mill Creek, WA 98012
Visit http://www.npspresbytery.org for more details

Engage Reggie as a team or come on your own.

Event Fee:
$25 includes seminar, materials and lunch
$10 for North Puget Sound Presbyterians—includes lunch
$0 for Pastor and Elder commissioners to North Puget Sound Presbytery meeting on September 21. A donation for lunch would be appreciated.

Event sponsored by North Puget Sound Presbytery

PRESENT FUTURE by Reggie McNeal
Tough Questions for the Modern Church

What questions are you asking?
In The Present Future, Reggie McNeal asks 6 tough questions of leaders in the church:

Wrong Question:
How can we do church BETTER?
Tough Question:
How do we convert from Churchianity to Christianity?

Wrong Question:
How do we grow this church? (a.k.a. How do we get THEM to come to US?)
Tough Question:
How do we transform our Community? (a.k.a. How do we hit the streets with the Gospel?)

Wrong Question:
How do we turn members into ministers?
Tough Question:
How do we turn members into MISSIONARIES?

Wrong Question:
How do we develop church members?
Tough Question:
How do we develop followers of Jesus Christ?

Wrong Question:
How do we plan for the future?
Tough Question:
How do we PREPARE for the future?

Wrong Question:
How do we develop leaders for church work?
Tough Question:
How do we develop leaders for a Christian movement?

Reggie McNeal Reggie McNeal is the director of leadership development for the South Carolina Baptist Convention. He has been speaking and consulting with congregations and denominational leaders of all denominations throughout the country. Through his various leadership roles, from pastoring congregations to denominational positions to seminary classrooms to coach and consultant for thousands of spiritual leaders, he has been devoted to helping spiritual leaders. McNeal is the author of Revolution in Leadership: Training Apostles for Tomorrow’s Church (1998), along with A Work of Heart: Understanding How God Shapes Spiritual Leaders (2000), the best-selling The Present Future: Six Tough Questions for the Church (2003), and Practicing Greatness: Seven Disciplines of Extraordinary Spiritual Leaders (2006) from Jossey-Bass.

reggie-mcneal.jpg

Book Description
In this provocative book, author, consultant, and church leadership developer Reggie McNeal debunks these and other old assumptions and provides an overall strategy to help church leaders move forward in an entirely different and much more effective way. In The Present Future, McNeal identifies the six most important realities that church leaders must address including: recapturing the spirit of Christianity and replacing “church growth” with a wider vision of kingdom growth; developing disciples instead of church members; fostering the rise of a new apostolic leadership; focusing on spiritual formation rather than church programs; and shifting from prediction and planning to preparation for the challenges of an uncertain world. McNeal contends that by changing the questions church leaders ask themselves about their congregations and their plans, they can frame the core issues and approach the future with new eyes, new purpose, and new ideas.

Cirque Du Soleil Upcoming Shows Info 2007

Press release concerning all the new shows on the way with Cirque…

Putting Creation First

CIRQUE DU SOLEIL OFFERS STIMULATING CREATIVE PLATFORMS
FOR CREATORS FROM HOME AND ABROAD

Montreal, September 13, 2007 – Ever since its founding in 1984, Cirque du Soleil has chosen to empower its creators and make creation the focal point of its activities. Over the last 23 years, more than a 100 creators have contributed their talent and vision to a Cirque du Soleil production. With new creation teams coming onboard for future projects, the total number of designers who have helped shape Cirque du Soleil shows is expected to reach 200.

Creativity is the driving force behind the organization’s unflagging growth. By 2010, Cirque du Soleil is expecting to open eight new shows, and no fewer than 60 creators from home and abroad are already hard at work conceiving and developing the new productions. “There’s no end of creative projects at Cirque du Soleil,” says Gilles Ste-Croix, Senior Vice‑President of Creative Content. “We have the good fortune of being able to attract renowned creators who want to work with us on a wide range of projects. Cirque du Soleil offers them stimulating creative platforms where they can explore and innovate. In turn, our creators’ vision and positive influence help expand Cirque du Soleil’s own ability to break new ground.”

“There’s no doubt that creativity is thriving in Quebec,” continues Gilles Ste-Croix. “In the years between now and 2010, Cirque du Soleil will be recruiting many Quebec-based directors and creators for its new shows. Quebec is overflowing with creative talent, and we are very proud to be able to offer them a high-profile international showcase.”

To successfully carry out so many creative undertakings at the same time, Cirque du Soleil sets up an independent creative unit to manage every project. Each unit is composed of nearly 100 dedicated individuals whose sole priority is to see their specific project through to a successful conclusion.

Below is a brief rundown of Cirque du Soleil projects currently in creation. Over the next three years, eight new shows will open around the world, joining 14 other shows already in performance. The directors and some creators have already been identified for these new creations.

Wintuk

Seasonal show opening at the WaMu Theatre at Madison Square Garden, New York City in November 2007

Richard Blackburn Director

Fernand Rainville Director of Creation

Patricia Ruel Set and Props Designer

François Barbeau Costume Designer

Simon Carpentier Composer

Jim Corcoran Songwriter

Catherine Archambault Choreographer

Yves Aucoin Lighting Designer

Francis Laporte Projections Designer

Jonathan Deans Sound Co-designer

Leon Rothenberg Sound Co-designer

Daniel Cola Acrobatic Performance Designer

Guy St-Amour Acrobatic Equipment and Rigging Designer

Eleni Uranis Make-up Designer

Tokyo 2008 (working title)

Resident show opening at Tokyo Disney Resort in Japan in 2008

François Girard Writer and Director

François Séguin Set Designer

Line Tremblay Director of Creation

Renée April Costume Designer

René Dupéré Composer

Debra Brown Choreographer

David Finn Lighting Designer

François Bergeron Sound Designer

Scott Osgood Acrobatic Equipment and Rigging Designer

Florence Pot Acrobatic Performance Designer

Macao I (working title)

Resident show opening at the Venetian Hotel in Macao, China in 2008

Gilles Maheu Director

Neilson Vignola Director of Creation

Guillaume Lord Set Designer

Dominique Lemieux Costume Designer

Axel Morghentaler Lighting Designer

Violaine Corradi Composer

Steve Dubuc Sound Designer

Martino Muller Choreographer

Guy Lemire Acrobatic Equipment and Rigging Designer

Rob Bollinger Acrobatic Performance Designer

Luxor 2008 (working title)

Resident show with Criss Angel opening at the Luxor Hotel in Las Vegas in 2008

Serge Denoncourt Director

Pierre Phaneuf Director of Creation

Christiane Barette Assistant to the Director of Creation

Ray Winkler Set Designer

Meredith Caron Costume Designer

Jeanette Farmer Lighting Designer

Eric Serra Composer

Jonathan Deans Sound Designer

Jaque Paquin Acrobatic Equipment and Rigging Designer

André Simard Acrobatic Performance Designer

Francis Laporte Projections Designer

Cirque 2009 (working title)

Touring show to be launched in Montreal in April 2009

Deborah Colker Director

Chantal Tremblay Director of Creation

Gringo Cardia Set Designer

Elvis 2009 (working title)

Resident show opening at City Centre Project in Las Vegas in 2009

Vincent Paterson Director

Armand Thomas Director of Creation

Mark Fisher Set Designer

Stefano Canulli Costume Designer

Marc Brickman Lighting Designer

Jonathan Deans Sound Designer

Guy St-Amour Acrobatic Equipment and Rigging Designer

Daniel Cola Acrobatic Performance Designer

Macao II (working title)

Resident show inspired opening in 2010 at a hotel yet to be built in Macao (China)

René Simard Director

Serge Roy Director of Creation

Stéphane Roy Set Designer

Alan Hranitelj Costume Designer

Alain Lortie Lighting Designer

Michel Cusson Composer

Steve Dubuc Sound Designer

Dubai 2010 (working title)

Resident show opening in 2010 at a hotel yet to be built in Dubai

Guy Caron Co-director

Michael Curry Co-director

Fernand Rainville Director of Creation

Cirque du Soleil

From the 20 or so performers that the company featured when it all began in 1984, Quebec-based Cirque du Soleil has become a leading provider of quality entertainment with over 3,800 employees, including 1,000 artists, from 40 different countries.

Cirque du Soleil has thrilled over 70 million spectators in more than 100 cities on four continents. In 2007, the organization will be presenting 15 shows simultaneously around the world. Cirque du Soleil has received such prestigious awards as the Emmy, Drama Desk, Bambi, ACE, Gemini, Félix and Rose d’or de Montreux. Its International Headquarters are in Montreal, Canada.

More information on Cirque du Soleil is available at www.cirquedusoleil.com.

Gene Autry’s Cowboy Code

Autry created the Cowboy Code or Cowboy Commandments in response to his young radio listeners aspiring to be just like Gene. I used to play keyboards for Roy Rogers Jr. – see Roy Rogers and Gene Autry had a friendly rivalry between them, all in good fun. But I’d bet my saddle that Roy would agree with this list too.

1. The Cowboy must never shoot first, hit a smaller man, or take unfair advantage.

2. He must never go back on his word, or a trust confided in him.

3. He must always tell the truth.

4. He must be gentle with children, the elderly, and animals.

5. He must not advocate or possess racially or religiously intolerant ideas.

6. He must help people in distress.

7. He must be a good worker.

8. He must keep himself clean in thought, speech, action, and personal habits.

9. He must respect women, parents, and his nation’s laws.

10. The Cowboy is a patriot.

Cabaret Flambe Musician Page

Musician info page for Cabaret Flambe at the Lincoln Theater – Fri October 12 and Sat October 13, 2007.

REHEARSALS:
Tuesday October 2nd – 9-11pm – Band only at TAG rehearsal space
Thursday October 4th – 9-11pm – Band only at TAG rehearsal space
Friday October 5th – 6-10pm band w/cast at Conway Muse

Since most players are also in the RHS band, we’ll combine some rehearsals as needed.

SONGS:

1) Cabaret – Jennings Watts

2) Dance me to the end of love – Peggy Wendel

3) Making Whoopee – Key Eb – Ria Peth

4) Piano solo – Conrad Askland

5) La Vie en Rose – Key C – Jennings & Lynnette?

6) Móðir mín í Kví Kví – Elfa Gisla

7) You Can Leave Your Hat on – Jennings Watts

8) Kiss of Fire – Peggy Wendel

9) Hernandos Hideaway Key Cm – Elfa Gisla?

10) Rock me baby – Key E – Ria Peth

11) Halleluiah – Lindsey Bowen

12) Transvestite – TAG – Rocky Horror Picture Show?

13) Everybody’s Girl – Sarah Simmons

Conrad rehearsal info:

 TUESDAY SEPTEMBER 18TH at 7-9 PM –

 Skits

Â

Â

7:00 – 7:15 – Móðir mín í Kví Kví – Elfa Gisla

Rocky Horror Show 2007

rhs-poster.png

Theater Arts Guild presents the ageless cult classic, The Rocky Horror Show, live on stage! Brad (Matt Riggins) & Janet (Karen Pollack) take a wrong turn and arrive at the castle of Dr. Frank-N-Furter (James Padilla). Uh-oh, here come Riff-Raff (Nathan McCartney), his sister Magenta (Joey Van Pelt), groupie Columbia (Martha McDade) and Frank’s delicious creation, ‘Rocky’ (Morgan Witt). Brad & Janet, dazed in sexual confusion, are saved by Dr. Scott (Randy Pratt). Did I mention Eddie (Joe Johnson) gets euthanized?

Costuming is welcome- grab your fishnets & stilettos. RHS contains mature themes, sexual situations, and strong language! Parental discretion is advised.

Rocky Horror Show
Lincoln Theater
712 S. 1st St. – Mount Vernon, WA 98273
http://www.lincolntheatre.org
Oct 26, 27, 31
Nov 1,2,3,8,9,10
8:00 pm
$20 All Seats; All Shows
$1 Preservation Fee
Reserved Seating

SYNOPSIS:

On the way to visit an old college professor, the two clean cut kids, Brad Majors and his fiancée Janet Weiss run into trouble and look for help at a light down the road. The light is coming from the old Frankenstein place, where Dr. Frank N Furter is in the midst of one of his maniacal experiments…Follow Brad and Janet on a trip they (and you) will never forget! Get ready for some fun, frolic, and frivolity. Rocky Horror is an ageless classic bursting at the seams with such memorable melodies as Sweet Transvestite, Dammit Janet, and, of course, the pelvic thrusting Time Warp. The Rocky Horror Show can’t stop partying! This is the boldest bash of them all, so fish out your fishnets, and sharpen your stilettos for the rockiest ride of your life!

Cirque Du Soleil

My first official Cirque Du Soleil post in plain english (I’ve done several posts in binary code, much to the delight of my fellow geek friends). So here’s the quick run down. Yes, I will be joining Cirque Du Soleil to open their new resident show in Macau, China at the Sands Venetian (Macao I) . I leave in January 2008. Scheduled opening for the show is May 2008.

Many people have trouble enunciating the company name – it’s “SIHRK DOO SOHLAY”, for regular English speaking folk. In French it means Circus of the Sun. There are a lot of knock-off companies that have chosen similiar sounding names – Cirque Du Soleil is the “real” one.

When people find out I’m joining CDS, I know immediately if they have seen a Cirque show before or not. The ones that haven’t seen CDS say something like “Oh, that’s cool”. The ones that HAVE seen a Cirque show before go into an uncontrolled frenzy and froth at the mouth, they go crazy. I’m not joking. I’ll tell you why: Cirque Du Soleil is the absolute coolest thing in the whole entire world. In this great wild world, there is nothing I would rather do more than work on one of their resident shows. To me, it is also the best music in the world – period.

Cirque Du Soleil is absolutely intense and ultimately demanding. It is the one thing I have seen in performance that eliminates all cultural boundaries and expresses takes on the human condition like no other art can. It is the ultimate voice of the artist demanding sense in the midst of insanity.

I have always loved the CDS music, and in the studio often used elements of their production styles in my work. But several years ago I saw Mystere and “O” live in Las Vegas with my mother and sister. After the Mystere show my mother asked me what I thought – I paused for a good while and said “I feel like my life has been changed, but I don’t know how.” I have never said anything like that about any other show. It woke me up. And since then it raised my bar of expectation for what can be.

So how did I get the gig? I auditioned in Las Vegas back when I was touring with Freddy Fender and producing for Road Records. We’ve gone back and forth on several different shows and productions, but nothing was quite the right timing or fit. This show is the perfect timing and the perfect fit.

I’ll tell you how perfect it is for me. My preference is to work for a resident show, meaning it has a theater built for it and stays in one place. My preference is also to work overseas (I spent MANY years playing in Vegas, it was fun but I already did that). The other great element is I get to experience the show in development from the beginning – to me that is the greatest part of it all – to see the Cirque magic unfold.

Theology aside – I think Cirque Du Soleil is the greatest thing this world has to offer. That’s my story and I’m stickin’ to it.

CHECK OUT INFO ABOUT CIRQUE DU SOLEIL

CIRQUE DU SOLEIL OVERVIEW

Cirque du Soleil (French for “Circus of the Sun”) is an entertainment empire based in Montreal, Quebec, Canada and founded in Baie-Saint-Paul in 1984 by two former street performers, Guy Laliberté and Daniel Gauthier. The current head choreographer is Debra Brown.

Initially named Les Échassiers they toured Quebec in 1980 as a performing troupe and encountered financial hardship that was relieved by a government grant in 1983 as part of 450th celebrations of Jacques Cartier’s discovery of Canada. The Le Grand Tour du Cirque du Soleil was a success in 1984 and after securing a second year of funding Laliberté hired Guy Caron from the National Circus School to recreate it as a “proper circus.” No ring and no animals helped make Cirque du Soleil the modern circus (“Cirque Nouveau” / New Circus) it is described as today. Each show is a synthesis of circus styles from around the world and has its own central theme and storyline which brings the audience into the performance by having no curtains, continuous live music and performers change the props/sets. After critical and financial successes (Los Angeles Arts Festival) and failures in the late 1980s, Nouvelle Expérience was created with the direction of Franco Dragone that not only made Cirque profitable by 1990 but allowed it to create new shows.

Throughout the 1990s and 2000s Cirque expanded rapidly and went from one show with 73 employees in 1984 to currently 3,500 employees from over 40 countries doing fifteen shows touring every continent and have an estimated annual revenue exceeding $600 million USD. The multiple permanent Las Vegas shows alone play to more than 9,000 people a night – 5% of the city’s visitors – adding to the 70+ million people who have experienced Cirque. In 2000, Laliberté bought out Gauthier and with 95% ownership has continued to expand the brand. Several more shows are in development around the world, along with a television deal, women’s clothing line and perhaps in other mediums such as spas, restaurants and nightclubs. Cirque’s creations have been awarded numerous prizes and distinctions, including Bambi, Rose d’Or, three Gemini Awards and four Primetime Emmy Awards In 2004, Interbrand’s poll of brand names with the highest global impact ranked Cirque du Soleil as number 22.

Nitrous Oxide and Pavarotti

nitrous-oxide-3d.png

nitrous-oxide-3d2.png

nitrous-oxide-3d3.png

luciano-pavarotti.jpg

How many of you can say you love going to the dentist? I can. Thanks to Pavarotti and Nitrous Oxide. I don’t know how many dentists do this now, but I put it on my top 100 of life experiences.

My dentist asked me if I wanted Nitrous and I said to do whatever made it less painful. Then they ask if I want an IPOD to listen to music. I don’t own an IPOD and I’ve really missed the boat on this one – the sound is INCREDIBLE! I dial through the selections and they have a Pavarotti folder of songs so I dial it in. Then they put on the Nitrous Oxide mask and ask me if I feel anything. Nope….

This nitrous stuff kind of creeps up on you real slow like….

In a couple minutes Panis Angelicus comes in with Luciano Pavarotti and a boychoir. My personal choice for one of the most beautiful songs ever written. And there I am sailing on Pavarotti’s vocal lines – like I’m surfing on a wave. It was absolutely beautiful. I try to remember feelings like that so I can recreate them later “sober”. The strongest feeling I get from it is disassociation. A disassociation of the boundary between listener and performer – as if you become a point (like a hanging microphone) in the middle of the performance.

Over an hour went by. I guess they were working on my teeth, I don’t know. I was listening to a concert. And very sad when they were finished – I wanted to listen to more music! At one point the dental tech tapped me, smiled and started conducting wildly – she knew I was having the time of my life.

My nephew tells me that they let him play video games at the dentist. Hey, when did dentists start doing all this and become so hip and cool? When I was a kid do you know what the big gimmick of dentists was? The Treasure Box. When you were done, you could choose one toy from the treasure box. And I took this task very seriously. Sometimes I would sit in front of the box for twenty minutes, because you could only choose one toy – and I didn’t want to make the wrong choice. Hey Doc, keep the toy – give me the Nitrous.

Now before anyone jumps on my case for talking about how great Nitrous is; do you remember the old days where you had to sit there for an hour at the dentist hearing constant scraping and gurgling. And if you still have a problem with it, I’ll be happy to go with you on your next visit to the dentist and sit next to you while you request no pain killers of any kind. Think of the fun we’ll have.

Until then: I LOVE MY DENTIST!

ABOUT NITROUS OXIDE

Nitrous oxide, dinitrogen oxide or dinitrogen monoxide, is a chemical compound with chemical formula N2O. Under room conditions, it is a colorless non-flammable gas, with a pleasant, slightly sweet odor and taste. It is used in surgery and dentistry for its anaesthetic and analgesic effects, where it is commonly known as “laughing gas” due to the euphoric effects of inhaling it.

History of Nitrous Oxide

The gas was first synthesized by English chemist and natural philosopher Joseph Priestley in 1775, who called it phlogisticated nitrous air. Priestley describes the preparation of “nitrous air diminished” by heating iron filings dampened with nitric acid in Experiments and Observations on Different Kinds of Air, (1775). Priestley was delighted with his discovery: “I have now discovered an air five or six times as good as common air… nothing I ever did has surprised me more, or is more satisfactory.” Humphry Davy in the 1790s tested the gas on himself and some of his friends, including the poets Samuel Taylor Coleridge and Robert Southey. They soon realised that nitrous oxide considerably dulled the sensation of pain, even if the inhaler were still semi-conscious. After it was publicized extensively by Gardner Quincy Colton in the United States in the 1840s, it came into use as an anaesthetic, particularly by dentists, who do not typically have access to the services of an anesthesiologist and who may benefit from a patient who can respond to verbal commands.

Inhalant Effects

Nitrous oxide (N2O) is a dissociative drug that can cause analgesia, depersonalization, derealization, dizziness, euphoria, flanging of sound, and slight hallucinations.

Use In Medicine

In the 1800s, nitrous oxide was used by dentists and surgeons for its mild analgesic properties. Today, nitrous oxide is used in dental procedures to provide inhalation sedation and reduce patient anxiety. In small doses in a medical or dental setting, nitrous oxide is very safe, because the nitrous oxide is mixed with a sufficient amount of oxygen using a regulator valve. However, extended, heavy use of inhaled nitrous oxide has been associated with Olney’s lesions in rats, though it is not necessarily possible to extrapolate it to humans.

Previously, nitrous oxide was typically administered by dentists through a demand-valve inhaler over the nose that only releases gas when the patient inhales through the nose; full-face masks are not used by dentists, so that the patient’s mouth can be worked on while the patient continues to inhale the gas. Current use involves constant supply flowmeters which allow the proportion of nitrous oxide and the combined gas flow rate to be individually adjusted. The masks still obviously cover only the nose.

Because nitrous oxide is minimally metabolized, it retains its potency when exhaled into the room by the patient and can pose an intoxicating and prolonged-exposure hazard to the clinic staff if the room is poorly ventilated. Where nitrous oxide is administered, a continuous-flow fresh-air ventilation system or nitrous-scavenging system is used, to prevent waste gas buildup.

Nitrous oxide is a weak general anesthetic, and so is generally not used alone in general anaesthesia. However, it has a very low short-term toxicity and is an excellent analgesic. In addition, its lower solubility in blood means it has a very rapid onset and offset, so a 50/50 mixture of nitrous oxide and oxygen (“gas and air”, supplied under the trade name Entonox) is commonly used for pain relief during childbirth, for dental procedures, and in emergency medicine.

In general anesthesia it is used as a carrier gas in a 2:1 ratio with oxygen for more powerful general anaesthetic agents such as sevoflurane or desflurane. It has a MAC (Minimum Alveolar Concentration) of 105% and a blood:gas partition coefficient of 0.Α46. Less than 0.004% is metabolised in humans.